Transcription - Cloudfront.net

download report

Transcript Transcription - Cloudfront.net

Video #2 DNA: The Blueprint of Life
Name the technology used in the movie Jurassic Park.
Where did Meissner extract the “nuclein” material that later was identified as DNA?
How did Hershey & Chase separate the virus from its bacterial host? How did they
trace (track) the DNA and protein?
What did x-ray crystallography reveal about DNA?
What purpose do enzymes serve in the replication process?
Segment #2:
Name the disorder that Andrew and his sister inherited. What were the major
symptoms of this disorder?
How can this genetic defect be treated? Name the gene that is defective.
How can a gene be transported and carried to a cell?
What is a vector? Give an example.
What purpose do restriction enzymes serve? What about ligase?
What does PCR stand for?
Segment #3:
What is the first step of gene therapy?
How long would all of the DNA contained in all of the chromosomes in a human
cell be if they were connected end to end?
Which chromosome consists of 5% of all the genes in the human genome?
Protein Synthesis: Chapter 17
Bridging the gap between Genotype & Phenotypes
(proteins are thought to be that link)
Trace the Flow of Information from Gene to Protein
Key Topics:
•
•
•
•
•
•
Garrod
Beadle & Tatum
Transcription (nucleus)
Processing mRNA
Translation (cytoplasm)
Completed polypeptide (protein)
Introductory Questions #3
Name the substance that accumulates in a person’s urine causing
alkaptonuria.
2) Why did Beadle and Tatum use breadmold spores to determine
that one gene forms one polypeptide allowing for the first
metabolic pathway to be defined?
3) Transcribe & Translate the following sequence of DNA by
determining the nucleotide sequence for mRNA, the anticodon
for tRNA, and the overall amino acid sequence:
TACTCAGGACCTGCAACGATT
mRNA:
???????????????????????????????
Amino acids Sequence:
???????????????????????????????
Anticodon:
???????????????????????????????
1)
4)
5)
How does the DNA and amino acid sequences differ from a
person with sickle cell anemia and a person with normal
hemoglobin in their RBC’s? (pg. 328)
When mRNA is “processed” what is taken out (spliced)?
Key Discoveries
•
•
•
•
•
•
•
•
•
•
•
•
Miescher (isolated “nuclein” from soiled bandages)
Garrod (Proteins & inborn errors)
Sutton
(Chromosome structure)
Morgan (Gene mapping)
Sumner (Purified Urease, showed it to be an enzyme)
Griffith’s Experiment (Transforming Principle)
Avery, McCarty, and Macleod
Chargaff (Base pairing & species specific)
Hershey and Chase
Pauling, Wilkins, and Franklin
Watson and Crick
Meselson & Stahl
1869
1902
1903
1913
1926
1928
1944
1947
1952
1950’s
1953
1956
Archibald Garrod (1902-1908)
• First to suggest that genes dictate phenotypes through
enzymes and their metabolic, catalytic properties.
• Studied a rare genetic disorder: Alkaptonuria
• Thought to be a recessive disorder
• Tyrosine is not broken down properly into carbon dioxide
and water.
• An Intermediate substance: “Homogentisic acid”
accumulates in the urine turning it BLACK when
exposed to air.
• An enzyme was thought to be lacking
• A genetic mutation was thought to be the cause
“An Inborn Error of Metabolism”
Metabolic Pathway for the
breakdown of Tyrosine
Tyrosine
↓
Hydroxyphenylpyruvate
↓
Homogentisic acid
Alkaptonuria
Inactive (lacking) enzyme
Maleyacetoacetate
(active ↓ enzyme)
CO2 & H2O
Garrod’s Conclusion
• A mutation in a specific gene is associated
with the absence of a specific enzyme.
• Led to the idea of:
“One gene, One Enzyme”
• Not validated until Beadle & Tatum’s work
in the 1940’s with Neurospora (breadmold)
James Sumner (1926)
•
•
•
•
Isolated the enzyme “Urease”
First to identify an enzyme as a protein
First to crystallize an enzyme
Awarded the Nobel prize in 1946 in
chemistry for his crystallization of an
enzyme.
• Studies of inherited metabolic disorders first
suggested that phenotype is expressed
through proteins
• Studies of the bread mold Neurospora crassa
led to the one gene-one polypeptide hypothesis
(Beadle & Tatum)
Figure 10.6B
George Beadle & Edward Tatum
• Discovered the “One Gene, One Enzyme” Principle
• Analyzed mutations that interfered with a known metabolic
pathway
• Organism they chose to work with: Neurospora
(breadmold)
-Grows easily
-Grows as a haploid: (no homologs)
-Mutants are easily identified: Dominant allele
won’t be expressed
• Neurospora (wild type) can grow easily in only: salt, sugar,
& Biotin (vitamin) = “Minimal Medium”
George Beadle & EdwardTatum cont’d
• Breadmold spores were bombarded with x-rays & UV
• Separated out the survivors: Mutants
• Haploid spores were crossed, grown in a variety of media to
determine what kind of mutation was occurring
• Mutants (had diff. nutritional needs vs. the wild types) –were
unable to make certain organic molecules: amino acids, lipids, etc.
when grown on the minimal media.
• Mutants cold grow on complete growth medium
• These mutants were grown in minimal media with one added
nutrient to determine the metabolic defect.
• Ex. Arginine was one nutrient that supported growth of the
mutants.
• Conclusion: These mutants had defective biochemical pathways
that allowed for the synthesis of arginine.
• **They examined the effect of the mutation instead of identifying
the enzyme.
Beadle & Tatum Experiment
w/Neurospora
Beadle & Tatum’s Conclusion
“One Gene affects One Enzyme”
Later  Revised
“One Gene affects One Protein”
Later

Revised
“One Gene affects One Polypeptide Chain”
THE FLOW OF GENETIC
INFORMATION
DNA → RNA → PROTEIN
• The information constituting an organism’s
genotype is carried in its sequence of bases
Genetic Information Written in Codons is
Translated into Amino acid Sequences
• The “words” of the DNA “language” are triplets
of bases called codons
– The codons in a gene specify the amino acid
sequence of a polypeptide
The Genetic Code Dictionary
• Virtually all organisms
share the same genetic
code
• 1st codon determined
was “UUU” by
Marshal Nirenberg in
1961.
• All of the codons were
determined by the mid
1960’s
Figure 10.8A
Gene 1
Gene 3
DNA molecule
Gene 2
DNA strand
TRANSCRIPTION
RNA
Codon
TRANSLATION
Polypeptide
Figure 10.7
Amino acid
Introductory Questions #3
Name the substance that accumulates in a person’s urine causing
alkaptonuria.
2) Why did Beadle and Tatum use bread mold spores to determine
that one gene forms one polypeptide allowing for the first
metabolic pathway to be defined?
3) Transcribe & Translate the following sequence of DNA by
determining the nucleotide sequence for mRNA, the anticodon
for tRNA, and the overall amino acid sequence:
TACTCAGGACCTGCAACGATT
mRNA:
???????????????????????????????
Amino acids Sequence:
???????????????????????????????
Anticodon:
???????????????????????????????
1)
4)
5)
How does the DNA and amino acid sequences differ from a
person with sickle cell anemia and a person with normal
hemoglobin in their RBC’s? (pg. 328)
When mRNA is “processed” what is taken out (spliced)?
Gene 1
Gene 3
DNA molecule
Gene 2
DNA strand
TRANSCRIPTION
RNA
Codon
TRANSLATION
Polypeptide
Figure 10.7
Amino acid
Protein Synthesis: overview
•
•
•
•
One gene-one enzyme hypothesis
(Beadle and Tatum)
One gene-one polypeptide (protein)
hypothesis
Transcription: synthesis of RNA
under the direction of DNA (mRNA)
Translation: actual synthesis of a
polypeptide under the direction of
mRNA
4) How many sites are present in the ribosome? Name
the enzyme that is used to attach an amino acid to the
Transcribed strand
tRNA molecule.
• An exercise in translating the genetic code
DNA
Transcription
RNA
Start
codon
Polypeptide
Translation
Stop
codon
Figure 10.8B
RNA polymerase
• In transcription, the
DNA helix unzips
DNA of gene
Promoter
DNA
– RNA nucleotides line
up along one strand of
the DNA following the
base-pairing rules
– The single-stranded
messenger RNA peels
away and the DNA
strands rejoin
Initiation
Elongation
Terminator
DNA
Area shown
in Figure 10.9A
Termination
Growing
RNA
Completed RNA
Figure 10.9B
RNA
polymerase
Transcription
• Occurs in the nucleus
• RNA Polymerase II is needed
-Adds nucleotides to the 3’ end only
-Eukaryotes have three types vs. Bacteria
with only one type
• Elongation occurs from 5’  3’ direction
• TATA Box : initiation site for the attachment of
RNA polymerase
• 3 Steps: Initiation  Elongation  Termination
Transcription: Initiation
• RNA Polymerase II binds to the “Promoter”
region on the DNA RNA Polymerase recognizes
this region because of the “TATA” box
• TATA Box is (upstream about 25 nucleotides from starting pt)
• Other proteins also are needed:
– Transcription factors
• These proteins must bind to the DNA first before
RNA Polymerase can bind and begin
Transcription.
• No Primer is needed, mRNA can made from
scratch
Transcription produces genetic
messages in the form of RNA
RNA
polymerase
RNA nucleotide
Direction of
transcription
Template
strand of DNA
Figure 10.9A
Newly made RNA
Transcription: Elongation
• DNA is untwisted (hydrogen bonds are broken)
• About 10 base pairs are exposed
• Nucleotides are are added to the 3’ end of
the growing mRNA molecule
• Proceeds at a rate of: 60 nucleotides/sec
Transcription: Termination
• Termination site is reached by RNA Polyermase
• In Eukaryotes “AATAAA” is the signal
• In Bacteria Translation can occur as it is released
from the first transcription event
• Final mRNA molecule is made consisting of
“Coded” and “Non-coded” regions
Transcription- The three Phases
Eukaryotic RNA is processed before
leaving the nucleus
• Noncoding
segments called
introns are spliced
out
• A cap and a tail
are added to the
ends
•
Exon Intron
Exon
Intron
Exon
DNA
Cap
RNA
transcript
with cap
and tail
Transcription
Addition of cap and tail
Introns removed
Tail
Exons spliced together
mRNA
http://highered.mcgrawhill.com/sites/0072437316/student_view0/c
hapter15/animations.html#
Coding sequence
NUCLEUS
CYTOPLASM
Figure 10.10
mRNA Structure
• 1) 5’ cap: modified guanine; protection; recognition site
for ribosomes
• 2) 3’ tail: poly(A) tail (adenine); protection;
recognition; transport
• 3) RNA splicing: involves introns & Exons
• Exons (expressed sequences) retained
• Introns (intervening sequences)
-These are spliced out / spliceosome
Key Regions on Newly Transcribed
mRNA
Various Types of RNA Molecules
Splicesomes w/ SNRP’s
(Small nuclear Ribonuclearprotein)
Animated View of Transcription
•
http://highered.mcgrawhill.com/sites/0072437316/student_view0/chapter15/animations.html#
Translation
• Occurs in the Cytoplasm
• Key molecules and structures include:
–
–
–
–
–
mRNA
tRNA
Ribosome (30s and 40s subunits)
Free floating amino acids
Endoplasmic reticulum
Translation: Overview
Transfer RNA molecules serve as
interpreters during translation
• In the cytoplasm, a
ribosome attaches to
the mRNA and
translates its
message into a
polypeptide
• The process is aided
by transfer RNAs
Amino acid attachment site
Hydrogen bond
RNA polynucleotide chain
Anticodon
Figure 10.11A
A Typical tRNA Molecule
Translation: Transfer RNA (tRNA)-Pg. 273
mRNA from nucleus is ‘read’ along its codons by tRNA’s
anticodons at the ribosome
tRNA – has the anticodon and amino acid attached
• Each tRNA molecule has a triplet anticodon on
one end and an amino acid attachment site on the
other
Amino acid
attachment
site
Anticodon
Figure 10.11B, C
Attachment of an Amino Acid (Pg 321)
Translation- the Ribosome
rRNA
site of mRNA codon &
tRNA anticodon coupling
P site
holds the tRNA carrying
the growing polypeptide
chain
A site
holds the tRNA carrying
the next amino acid to be
added to the chain
E site
discharged tRNA’s
Animated View of Transcription
•
http://highered.mcgrawhill.com/sites/0072437316/student_view0/chapter15/animations.html#
Video #4:Proteins-Building Blocks of
Life
• Name the structures identified by Dr. James Lake that
has helped him to trace the hereditary path of life back to
the first cell.
• What type of therapy is suggested by Dr. Richard Firtel
that may provide long term help for patients suffering
from sickle cell anemia?
• In the third segment what type of organism is profiled?
How do prokaryotic cells switch protein production on
and off?
Be sure to write the title for all three
segments and list five key statements for
each segment.
Translation
• Initiation~
union
of mRNA, tRNA, small
ribosomal subunit; followed by
large subunit
• Elongation~
•codon
recognition •peptide bond
formaton •translocation
• Termination~
‘stop’
codon reaches ‘A’ site
• Polyribosomes: translation
of mRNA by many ribosomes
(many copies of a polypeptide
very quickly)
Transcription & translation in
Prokaryotes
Mutations & Errors During
Transcription & Translation
DNA Repair
• Mismatch repair:
DNA polymerase
• Excision repair:
Nuclease
• Telomere ends:
telomerase
Mutations can change the meaning of genes
• Mutations are changes in the DNA base
sequence
– These are caused by errors in DNA replication or by
mutagens
– The change of a single DNA nucleotide causes
sickle-cell disease
DNA Mutations & Modifications
• Point mutations
-changes in 1 or a few base pairs in a single gene
-most common
• Base-pair substitutions:
•silent mutations
•missense
•nonsense
no effect on protein
∆ to a different amino acid (different protein)
∆ to a stop codon and a nonfunctional protein
• Base-pair insertions or deletions:
-additions or losses of nucleotide pairs in a gene; alters the ‘reading
frame’ of triplets
-frameshift mutation
• Mutagens: physical and chemical agents that change DNA
• Types of mutations
NORMAL GENE
mRNA
Protein
Met
Lys
Phe
Gly
Ala
Lys
Phe
Ser
Ala
BASE SUBSTITUTION
Met
Missing
BASE DELETION
Met
Lys
Leu
Ala
His
Figure 10.16B
Normal hemoglobin DNA
mRNA
Mutant hemoglobin DNA
mRNA
Normal hemoglobin
Sickle-cell hemoglobin
Glu
Val
Figure 10.16A
Mutations: genetic material changes in a cell
Chapters 18 & 19
Bacteria
Viruses & Operon Systems
Key Topics and Text Pgs to Review
Topic
Bacteria:
Genetic recombination
Plasmids & Conjugation
Transformation (Lab #8)
Transposons:
Lac Operon System
Regulating Gene Expression
Viruses: DNA, RNA (retroviruses)
Lytic & Lysogenic Cycle
Pgs.
346-350
351-352
353-356
338-342
337-339
Relative size Differences between of Viruses,
Prokaryotes, and Eukaryotes
Bacterial Reproduction of DNA
The Transfer of a Plasmid
Detecting Genetic Recombination in
Bacteria
Regulation of a Metabolic Pathway
Introductory Questions #4
1) Name the two scientists that discovered the Lac
operon system.
2) How are repressible operons different from inducible
operons? Give an example of each.
3) What is the difference between an operator and a
promoter?
4) Why are transposons called “jumping genes”? What
purpose do the insertion sequences play?
5) Name three example of a virus that has DNA as its
genetic material and three examples of Viruses with
RNA as its genetic material.
6) Briefly explain what a vaccine is and what it does.
Repressible Operons (trp operon)
• Usually “ON” - to turn OFF:
– Co-repressor needs to bind to an inactive
repressor and activate it
– RNA Polymerase then cannot bind and transcribe
mRNA
Ex. trp operon is a repressible operon:
-trancription is usually on
-inhibited only by tryptophan (corepressor)
Trp Operon when Tryptophan is Absent
http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter18/animations.html#
INDUCIBLE Operons (ex. lac operon)
• Usually “OFF” - to turn ON:
– INDUCER needs to bind to an active
repressor and inactivate it
– RNA Polymerase can then bind and transcribe
mRNA
Ex. Lac operon is an inducible operon
Lac Operon
• Lactose ONLY used when glucose is not present
in large quantities
• When glucose is present, cAMP levels are low,
cAMP cannot bind to CAP and initiate enzyme
production
Inactive Repressor-Lactose Present
http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter18/animations.html
Lac Operon
• In absence of glucose, cAMP levels are
HIGH, binding to CAP can occur
• Beta-Galactosidase is made
Lac Operon
• RNA polymerase only binds efficiently when
cAMP-CAP complex is in place
• Lac Operon = an INDUCIBLE Operon
• Lactose = an INDUCER
– Binds to repressor and inactivates it