GeneToProtein

download report

Transcript GeneToProtein

From Gene
to Protein
How Genes
Work
AP Biology
2007-2008
What do genes code for?

How does DNA code for cells & bodies?

how are cells and bodies made from the
instructions in DNA
DNA
AP Biology
proteins
cells
bodies
The “Central Dogma”

Flow of genetic information in a cell

How do we move information from DNA to proteins?
DNA
replication
AP Biology
RNA
protein
trait
1941 | 1958
Beadle & Tatum
one gene : one enzyme hypothesis
George Beadle
Edward Tatum
AP Biology
"for their discovery that genes act by
regulating definite chemical events"
a
a
From gene to protein
nucleus
cytoplasm
transcription
DNA
a
a
translation
mRNA
a
a
a
a
a
a
a
a
a
a
a
protein
a
a
a
a
a
a
a
ribosome
trait
AP Biology
Transcription
from
DNA language
to
RNA language
AP Biology
2007-2008
RNA


ribose sugar
N-bases
uracil instead of thymine
U : A
C : G



single stranded
lots of RNAs

DNA
AP Biology
mRNA, tRNA, rRNA
transcription
RNA
Transcription

Making mRNA


transcribed DNA strand = template strand
enzyme

RNA polymerase
coding strand
5
C
DNA
G
3
A
G
T
A T C
T A
53
A G C
A
T
C G T
A
C
T
3
G C A U C G U
C
G T A G C A
T
T
A
C
A G
C T
G
A
T
A
T
3
5
unwinding
rewinding
mRNA
AP Biology
build
RNA
G
5
RNA polymerase
template strand
Initiation

Promoter region
binding site before beginning of gene
 TATA box binding site
 binding site for RNA polymerase

AP Biology
Elongation

Match RNA bases to DNA
bases on one of the DNA
strands
A
G
C
A
G
G
U
U
C
A
AG
U
C
G
A
U
A
C
5'
RNA
A C C polymerase G
A
U
3'
T G G T A C A G C T A G T C A T CG T A C CG T
AP Biology
U
C
Termination

Eventually the RNA transcript is
released and the polymerase detaches
(complete mechanism still not fully
known)
AP Biology
Eukaryotic genes have junk!

Eukaryotic genes are not continuous

exons = the real gene


expressed / coding DNA
introns
come out!
introns = the junk

inbetween sequence
intron = noncoding (inbetween) sequence
eukaryotic DNA
exon = coding (expressed) sequence
AP Biology
mRNA splicing

Post-transcriptional processing




eukaryotic mRNA needs work after transcription
primary transcript = pre-mRNA
mRNA splicing
 edit out introns
make mature mRNA transcript
intron = noncoding (inbetween) sequence
~10,000 base
eukaryotic DNA
exon = coding (expressed) sequence
pre-mRNA
primary mRNA
transcript
AP Biology
mature mRNA
transcript
~1,000 base
spliced mRNA
Splicing must be accurate

No room for mistakes!

a single base added or lost throws off the
reading frame
AUGCGGCTATGGGUCCGAUAAGGGCCAU
AUGCGGUCCGAUAAGGGCCAU
AUG|CGG|UCC|GAU|AAG|GGC|CAU
Met|Arg|Ser|Asp|Lys|Gly|His
AP Biology
AUGCGGCTATGGGUCCGAUAAGGGCCAU
AUGCGGGUCCGAUAAGGGCCAU
AUG|CGG|GUC|CGA|UAA|GGG|CCA|U
Met|Arg|Val|Arg|STOP|
RNA splicing enzymes
snRNPs
snRNA
intron
exon
exon
5'
3'
spliceosome
5'
3'
lariat
5'
mature mRNA
AP Biology
exon
5'
3'
exon
3'
excised
intron
Alternative splicing

Alternative mRNAs produced from same gene


AP Biology
when is an intron not an intron…
different segments treated as exons
More post-transcriptional processing

Need to protect mRNA on its trip from
nucleus to cytoplasm

enzymes in cytoplasm attack mRNA



protect the ends of the molecule
add 5 GTP cap
add poly-A tail
 longer tail, mRNA lasts longer: produces more protein
3'
mRNA
5'
AP Biology
P
G P
P
A
a
a
From gene to protein
nucleus
cytoplasm
transcription
DNA
a
a
translation
mRNA
a
a
a
a
a
a
a
a
a
a
a
protein
a
a
a
a
a
a
a
ribosome
trait
AP Biology
Translation
from
nucleic acid language
to
amino acid language
AP Biology
2007-2008
How does mRNA code for proteins?
DNA
TACGCACATTTACGTACGCGG
4 ATCG
mRNA
4 AUCG
protein
AUGCGUGUAAAUGCAUGCGCC
?
Met Arg Val Asn Ala Cys Ala
20
AP Biology
How can you code for 20 amino acids
with only 4 nucleotide bases (A,U,G,C)?
mRNA codes for proteins in triplets
AP Biology
Cracking the code

1960 | 1968
Nirenberg & Khorana
Crick

determined 3-letter (triplet) codon system
WHYDIDTHEREDBATEATTHEFATRAT

Nirenberg (47) & Khorana (17)
determined mRNA–amino acid match
 added fabricated mRNA to test tube of
ribosomes, tRNA & amino acids



AP Biology
created artificial UUUUU… mRNA
found that UUU coded for phenylalanine
The code

Code for ALL life!


strongest support for
a common origin for
all life
Code is redundant


several codons for
each amino acid
3rd base “wobble”

Start codon



AP Biology
AUG
methionine
Stop codons

UGA, UAA, UAG
How are the codons matched to
amino acids?
DNA
mRNA
3
5
5
3
TACGCACATTTACGTACGCGG
AUGCGUGUAAAUGCAUGCGCC
3
UAC
tRNA
amino
acid
AP Biology
Met
codon
5
GCA
Arg
CAU
Val
anti-codon
a
a
From gene to protein
nucleus
cytoplasm
transcription
DNA
a
a
translation
mRNA
a
a
a
a
a
a
a
a
a
a
a
protein
a
a
a
a
a
a
a
ribosome
aa
trait
AP Biology
Transfer RNA structure

“Clover leaf” structure
anticodon on “clover leaf” end
 amino acid attached on 3 end

AP Biology
Loading tRNA

Aminoacyl tRNA synthetase


enzyme which bonds amino acid to tRNA
bond requires energy



ATP  AMP
bond is unstable
so it can release amino acid at ribosome easily
Trp C=O
OH
OH
Trp C=O
O
Trp
H2O
O
activating
enzyme
tRNATrp
anticodon
AP Biology
tryptophan attached
to tRNATrp
AC C
UGG
mRNA
tRNATrp binds to UGG
condon of mRNA
Ribosomes

Facilitate coupling of
tRNA anticodon to
mRNA codon


organelle or enzyme?
Structure
ribosomal RNA (rRNA) & proteins
 2 subunits



AP Biology
large
small
E P A
Ribosomes

A site (aminoacyl-tRNA site)


P site (peptidyl-tRNA site)


holds tRNA carrying next amino acid to
be added to chain
holds tRNA carrying growing
polypeptide chain
Met
E site (exit site)

AP Biology
empty tRNA
leaves ribosome
from exit site
U A C
A U G
5'
E
P
A
3'
Building a polypeptide

Initiation


Elongation


brings together mRNA, ribosome
subunits, initiator tRNA
adding amino acids based on
codon sequence
Termination

3 2 1
end codon
Leu
Val
Met
Met
Met
Met Leu
Ala
Leu
Leu
release
factor
Ser
Trp
tRNA
U AC
5'
C UGAA U
mRNA A U G
3'
E P A
AP Biology
5'
UAC GAC
A U G C U GAA U
5'
3'
U A C GA C
A U G C U G AAU
5'
3'
U AC G A C
AA U
AU G C U G
3'
A CC
U GG U A A
3'
Destinations:
Protein targeting



Signal peptide

address label




start of a secretory pathway
AP Biology

secretion
nucleus
mitochondria
chloroplasts
cell membrane
cytoplasm
etc…
RNA polymerase
DNA
Can you tell
the story?
amino
acids
exon
intron
tRNA
pre-mRNA
5' GTP cap
mature mRNA
aminoacyl tRNA
synthetase
poly-A tail
large ribosomal subunit
polypeptide
5'
small ribosomal subunit
AP Biology
tRNA
E P A
ribosome
3'
The Transcriptional unit (gene?)
enhancer
exons
1000+b
20-30b
3'
transcriptional unit (gene)
RNA
TATA
polymerase
5'
DNA
DNA
introns
promoter
5'
pre-mRNA
AP Biology
5'
GTP mature mRNA
3'
3'
AAAAAAAA