Click here for powerpoint

download report

Transcript Click here for powerpoint

Turn in DNA letter
 Begin reading Analogy Story and
answer the questions

Don’t worry about the back page
Regents Biology
Watch animation
 Ask questions if something is unclear
 Then we’ll take a few notes about what
we discussed
 Tomorrow you’ll take what we learned
to decode genetic instructions, find out
what a fictional creature looks like
based on the instructions and draw it.
Regents Biology
Protein Synthesis
Making Proteins
Regents Biology
2009-2010
Bodies  Cells  DNA
 Bodies are made up of cells
 All cells run on a set of instructions
spelled out in DNA
Regents Biology
DNA  Cells  Bodies
 How does DNA code for cells & bodies?

how are cells and bodies made from the
instructions in DNA
Regents Biology
DNA  Proteins  Cells  Bodies
 DNA has the info to build proteins
proteins
cells
Regents Biology
bodies
DNA gets all the glory,
Proteins do all the work
How do proteins do all the work
 Proteins
proteins run living organisms
 enzymes

 control all chemical reactions in living
organisms

structure
 all living organisms are built out of proteins
Regents Biology
Cell organization
 DNA

DNA is in the nucleus
 genes = instructions for making proteins

want to keep it there = protected
 “locked in the vault”
cytoplasm
nucleus
Regents Biology
Cell organization
 Proteins



aa
aa
aa
chains of amino acids
aa
made by a “protein factory” in cytoplasm aa
protein factory = ribosome
aa
cytoplasm
aa
aa
aa
aa
build
proteins
nucleus
ribosome
Regents Biology
aa
aa
Passing on DNA information
 Need to get DNA gene information
from nucleus to ribosome
aa
aa
aa
The code to make protein is in DNA.
aa
 Since DNA can’t leave the nucleus a copy
aa
called mRNA is made, which is sent to the
aa
ribosome to then make protein
aa

aa
build
proteins
mRNA
cytoplasm
nucleus
Regents Biology
ribosome
aa
aa
aa
From nucleus to cytoplasm
aa
aa
aa
aa
transcription
DNA
mRNA
aa
aa
protein
aa
translation
trait
nucleus
Regents Biology
cytoplasm
DNA vs. RNA
DNA
 deoxyribose sugar
 nitrogen bases



G, C, A, T
T:A
C:G
 double stranded
Regents Biology
RNA
 ribose sugar
 nitrogen bases



G, C, A, U
U:A
C:G
 single stranded
Transcription
 Making mRNA from DNA
 DNA strand is the
template (pattern)

match bases
U:A
G:C
 Enzyme

RNA polymerase
Regents Biology
Matching bases of DNA & RNA
 Double stranded DNA unzips
T G G T A C A G C T A G T C A T CG T A C CG T
Regents Biology
Matching bases of DNA & RNA
 Double stranded DNA unzips
T G G T A C A G C T A G T C A T CG T A C CG T
Regents Biology
Matching bases of DNA & RNA
 Match RNA bases to DNA
C
G
bases on one of the DNA
strands
U
A
G
G
U
U
C
A
AG
A
C
G
A
U
A
C
A C C
RNA
polymerase
A
U
G
T G G T A C A G C T A G T C A T CG T A C CG T
Regents Biology
U
C
Matching bases of DNA & RNA
 U instead of T is matched to A
aa
aa
aa
DNA
TACGCACATTTACGTACGCGG
aa
aa
aa
mRNA
AUGCGUGUAAAUGCAUGCGCC
aa
aa
aa
aa
ribosome
A C C A U G U C G A U C A G U A G C A U G G C A
Regents Biology
Once a copy is made in the
nucleus mRNA goes to the
ribosome
TRANSLATION: ribosome
decodes the instructions on
mRNA and makes a protein
Regents Biology
How does mRNA code for proteins
 mRNA leaves nucleus
 mRNA goes to ribosomes in cytoplasm
 Proteins built from instructions on mRNA
How?
mRNA
A C C A U G U C G A U C A GU A GC A U G GC A
aa
Regents Biology
aa
aa
aa
aa
aa
aa
aa
Codes are written in groups of 3 letters
(codon)
codon
DNA
mRNA
Regents Biology
TAC GCA
AUG CGU
tRNA
tRNA
Met
Arg
mRNA to protein = Translation
 The working instructions  mRNA
 The reader  ribosome
 The transporter  transfer RNA (tRNA)
ribosome
mRNA
A C C A U G U C G A U C A GU A GC A U G GC A
U GG
tRNA
aa
aa
aa
Regents Biology
U A C
tRNA
aa
A G
C
tRNA U A G
aa
tRNA
aa
aa
cytoplasm
aa
protein
aa
aa
aa
transcription
translation
aa
aa
aa
aa
aa
aa
nucleus
trait
Regents Biology
Whoops!
See what happens when
your genes don’t work right!
Any Questions??
Regents Biology
2009-2010