introduction figures

download report

Transcript introduction figures

3
ADP-ribosyl Transferase
Acceptor
Acceptor
Arg
C
O
NAD+
C
C
NH2
N
HO
N
OH
N
nicotinamide
C
N
Arg
O
O
HO
P O
O
HO
P O
O
O
Adenine
OH OH
ADP-ribose
Figure 1: ADP ribosylatoin.
The principal reaction of mono ADP-ribosyltion is illustrated. Adapted from
Ziegler et. al., 2000.
5
Pi
GDP
a-subunit
Gs
Gbg
a-subunit
Gs
1
Adenyl
cyclase
inactive
GTP
NAD+
Cholera
toxin
2
nicotinamide
ADPR
a-subunit
Gs
GTP
Adenyl
cyclase
PPi + cAMP
3
ATP
4
Na+ and H2O
Figure 2: Modification with ADP-ribose of a heterotrimeric G protein in the host cell
catalyzed by cholera toxin.
Step 1 outlines the normal function of a-subunit of Gs protein which upon hydrolysis
of GTP to GDP leads to inactivation of adenyl cyclase (AC). ADP ribosylation of
a-subunit of Gs by cholera toxin leads to activation of AC (step 2). Constant
stimulation of AC leads to accumulation of cAMP levels in the cell (step 3) resulting
in loss of sodium and water (step 4).
7
N
N
N
O N
O N
NH2
N
N
N
P
O O
N
P
5
OH
OH
P
O
O
P
OH
O
NH2
C O
O O C
5
OH
OH
6
OH
OH
P
O O
N
P
N
O N
P
OH
O
OH
NH2
N
N
O N
P
OH
OH
NH2
N
NH2
N
O
OH
OH
C
Acceptor protein
N
N
O
P
O
O
P
NH2
N
N
N
N
NH2
NH2
N
N
O
P
N
O
P
4
N
O
NH2
N
N
N
O
NH2
N
P
O
P
P
P
P
O
O OH
O
O
N
N
P
N
P
O
OH OH
O OH
OH
N
O
NH2
O
N
P
N
O
H
H
OH OH
HO
Nicotinamide
HO
N
O
N
O
P
H
OH OH
ADPr
N
N
O
OH OH
O
HO
N
O
N
N
P
N
P
O
OH OH
H
OH OH
n
N
O
O
P
N
P
NH2
H
H
O
P
P
HO
N
N
N
N
NH2
N
O
N
P
OH
OH OH
NAD+
NH2
O
2
N
H
NH2
O
O
O
O
OH OH
N
P
NH2
H
N
P
NH2
P
N
N
P
N
OH OH
N
O
O
N
O
P
O
N
N
N
NH2
OH OH
N
O
P
OH OH
NH2
C O
HO
O O OH
OH
OH OH
OH OH
O
P
P
O
3
O C
OH OH
NH2
N
O
N
O
1
N
N
P
P
N
OH OH
OH OH
N
O
NH2
N
N
N
N
N
OH
O OH
N
N
HO
OH
Figure 3: Poly ADP ribose metabolism.
Two enzymes (glycohydrolase[PARG] and lyase) are responsible for degradation of
of poly ADP ribose. The lyase is responsible for the hydrolysis of the most proximal
unit of the polymer attached to the acceptor protein (1). PARG possess both exo and
endo glycosidase activity (2 and 3) and is responsible for hydrolysis of the bond
within the polymer. The synthesis of this polymer is accomplished by PARP which
catalyzes the initiation (6), elongation (5), and branching(4) reactions.
OH
9
Figure 4: Ribbon diagram of the catalytic fragment of PARP-1 in complex with
NAD+.
The core of the C-terminal domain is formed by a five-stranded antiparallel bsheet and a four-stranded mixed b-sheet. The NAD+ binds in the cleft at the
junction of the two central b-sheets shown in red where it is lined by the chain
segment shown in blue. The segment shown in blue contains a block of 50
amino acids that are identical in all PARP sequences of vertebrates.
10
Figure : Modification with ADP-ribose of a heterotrimeric G protein in the host cell
catalyzed by cholera toxin.
Step 1 outlines the normal function of a-subunit of Gs protein which upon hydrolysis of GTP to
GDP leads to inactivation of andenyl cyclase (AC). ADP ribosylation of a-subunit of Gs by
cholera toxin leads to activation of AC (step 2). Constant stimulation of AC leads to
accumulation of cAMP levels in the cell(step 3) resulting in loss of sodium and water (step4).
12
Cyclic ADP-ribose
OH OH
O
NAADP+
O
O
N
P OH
N
O
Generation of NAADP+
requires nicotinic acid
instead of nicotinamide
O
NH2
N
P OH
N
O
O
O
OH
Ring opening
reaction with H2O
OH OH(P)
N
Nicotinic Acid
Cyclization
O
O
O
OH
P OH OH
NH2
O
O
P OH N
O
O
N
H2O
N
O
O
NH2
OH OH(P)
H
O
N
O
O
OH
OH
P OH OH
NH2
O
O
O
O
NH2
O
O
O
P OH OH OH
O
P OH N
O
O
N
P OH N
O
N
N
NH2
N
N
Nicotinamide
OH OH(P)
ADP-Ribose
OH OH(P) NAD(P)+
Reaction with nucleophiles such as water
Figure 6: Reaction mechanism of NAD+ glycohydrolase/ADP-ribosyl cyclases.
Adapted from Zeigler et. al., 2000.
14
Figure 7 : Ribbon drawing of exotoxin A proenzyme.
The receptor binding domain (Ia) is shown in green,
domain (Ib) is in yellow,the translocation domain is in red
and the catalytic domain is in blue. The above structure was
generated in Web Lab Pro 3.7 using the coordinates
provided kindly by Dr. D. McKay.
19
1
2
5
3
6
4
Figure 9. Intoxication pathway of Pseudomonas aeruginosa exotoxin A.
The intoxication starts with binding of the toxin to specific receptors on
the target cell and ends with the translocation of the catalytic fragment of
the toxin to the cytoplasm where the toxin acts on its target. For details of
the steps involved see text: step 1, binding and internalization of the
toxin; step 2, partial unfolding and cleavage of whole toxin in the
endosome; step 3, translocation from endosomes to the Gogi apparatus;
step 4, translocation to ER through retrograde pathway; step 5 reduction
of disulfide bond; and step 6 release of catalytic fragment into the
cytoplasm.
22
Figure 10: Ribbon diagram of EF-G.
Domain I, its GTP binding domain, is blue, and domains 2, 3, 4,
and 5 are orange, red, green, and purple, respectively. The
above diagram was generated using Web Lab Pro 3.7 using the
x-ray coordinates deposited in Brookhaven Protein Data Bank.
(Czworkowski et al., 1994, PDB entry 2EFG).
24
Table 1: Inhibitors of PARP.
Group
Compound
I. Nicotinamide analogs
Nicotinamide
Structure
%inhibition
89
O
NH2
N
1Methylnicotinamide
29
O
NH2
N
CH3
Nicotinic acid
0
O
OH
N
II. Benzamide analogs
3-Aminobenzamide
O
96
H2N
NH2
2-Aminobenzamide
NH2
75
O
NH2
Benzoic acid
0
O
OH
III. Purine analogs
Theophylline
O
H3C
H
89
N
N
O
N
N
CH3
Caffeine
O
H3C
CH3
O
35
N
N
N
N
CH3
6-mercaptopurine
H3C
SH
H
16
N
N
N
N
Comparison of the inhibitory action of analogs of various parts of
NAD+ molecule. The data were taken from Sims et al., 1982. All
the compounds were tested at a concentration of 2 mM. The inhibition
is expressed as percent of the PARP activity of untreated control cells.
25
H
O
N
O
Figure 11: Structure of 1,8-naphthalimide (Naph).
A vast number of inhibitors based on the above structure have
been sythesized.
26
DT
PARP
Figure 12: Comparison of structural features of the catalytic domains of poly and
mono ADPRTs.
The ribbon diagram of two bacterial mono ADPRTs (ETA & DT) and
eukaryotic Poly ADPRT (PARP-1) is shown above. The colored regions
show the residues that can be superimposed in all three structures. The
similarity of the NAD+ binding cleft in these structures indicates that these
enzymes comprise the superfamily of ADPRTs.
ETA
40
Table 2: Details of the site directed mutagenesis of PE24.
Plasmid
pPE5-399
Complementary Primer used (5’---->3’)
CCTCGACCCGTGCAGCATCCCCG
Mutations
in PE24
S585C
CGGGGATGCTGCACGGGTCGAGG
pPE5-399
CTACCGCACCTGCCTGACCCTGG
S515C
CCAGGGTCAGGCAGGTGCGGTAG
pPE5-399
GCTACCACGGCTGCTTCCTCGAAGC
T442C
GCTTCGAGGAGGCAGCCGTGGTAGC
pPE5-399
CGGCGACGTCTGCTTCAGCACCC
S408C
GGGTGCTGAAGCAGACGTCGCCG
pPE5-399
CCGCGCTCGTGCCTGCCGG
S507C
CCGGCAGGCACGAGCGCGG
pPE5-399
CCCAGGACCAGTGTCCCGACGC
G486C
GCGTCGGGACACTGGTCCTGGG
The incorporation of the desired site specific mutation(s) was achieved by
the use of complementary primers containing the desired mutation (bold
underlined codon). The incorporation of the desired mutations was
confirmed by the determination of the nucleotide sequence.
PCR experiments were performed with the aid of a MiniCycler ™
thermocycler manufactured by MJ Research (Kailua, HI).
41
Table 3 : Primers used for effecting Site-directed mutagenesis by
Kunkel procedure.
Plasmid
Primer (5’---->3’)
pPE5-399
CGAAGCGGCGCAATGCATCGTCTT
Mutations
in PE24
S449C
Change in R.E.
site
Sau 96 cut site
pPE5-399
GGGAGCGCGCGCGCGCTGCCAGGACCT
S459C
Rsa I cut site
pPE5-399
GCACGGCGCCCATGTCTTCGACTGC
S410C
Rsa I cut site
In pPE5-399, the catalytic domain of the tox A gene is under control of a
T7 promoter. The PE24 gene in this plasmid contains an Omp A signal
sequence that is cleaved upon secretion of PE24 into the periplasm. The
plasmid also contains repeat of the trinucleotide, CAT, that codes for a poly
His sequence at the C-terminus of the PE24 protein.
The incorporation of the desired site-specific muation(s) was achieved by
the use of the primers containing the mutation of interest (underlined and
bold codon). The incorporation of the desired mutation(s) was confirmed
both on the basis of the product(s) generated upon treatment with the
restriction enzyme(s) as well as by the determination of the nucleotide
sequence.
48
Table 4: Reaction conditions for chemical modification of PE24 variants.
Protein
DTT
Reaction
1,5-IAEDANS
Reaction
Molar excess
Time with DTT
Molar excess
Time with IAEDANS
S408C**
50
2 hrs
100
2 hrs
S410C
10
30 min
30
25 min
T442C
10
30 min
30
25 min
S449C
10
30 min
30
25 min
S459C
10
30 min
30
25 min
G486C
10
30 min
30
25 min
S507C
10
30 min
30
25 min
S515C**
20
1 hr
50
1.5 hrs
S585C
10
30 min
20
15 min
Each of the protein preparations were incubated in 200 mM Tris, pH 8.1 with
the indicated excess of DTT (mol DTT: mol PE24) at 4 ºC. A concentrated
solution of IAEDANS was added to the reaction mixture to give a molar
excess as indicated above (IAEDANS: PE24 variant + DTT). The reaction
mixture was gently mixed on a nutator for specified amount of time at room
temperature.
* indicates the reaction mixtures that were incubated at r.t. with DTT.