DNA Transcription and Translation

download report

Transcript DNA Transcription and Translation

DNA Transcription and
Translation
Sections 12.3 and 12.4
Do Now

1. What is RNA

2. How does it differ from DNA?

3. What is protein?
Gene


Segment of DNA that codes for a
protein
DNA codes for RNA and RNA makes
protein
One Gene – One Enzyme




The Beadle and Tatum experiment
showed that one gene codes for one
enzyme.
One gene codes for one polypeptide.
polypeptide - a chain of covalently
bonded amino acids.
(proteins are made of one or more
polypeptide)
12.3 DNA, RNA, and
Protein
Let’s make some observations
about RNA’s structure
RNA

RNA stands for:


Ribonucleic acid
RNA is found:

Nucleus and Cytoplasm
RNA Structure

Like DNA, RNA is made up of subunits
called _____________, which are made
of three parts:



Sugar (ribose)
Phosphate
Nitrogen Base
RNA’s Nitrogen Bases




Adenine (A)
Cytosine (C)
Guanine (G)
Uracil (U)
There are 3 types of RNA:



Messenger RNA (mRNA)
Ribosomal RNA (rRNA)
Transfer RNA (tRNA)
All RNA is …



Single stranded
Many different shapes
“Cheap copy” of DNA
Do Now


1. What is a protein made of?
2. Explain the process between DNA
and proteins.
Transcription




First step in making proteins
Process of taking one gene (DNA) and
converting into a mRNA strand
DNA -> RNA
Location:

Nucleus of the cell
Steps to Transcription

1. An enzyme attaches to the promoter
(start signal region) of a gene and
unwinds the DNA
Steps to Transcription (Cont.)

2. One strand acts as a template.
Steps to Transcription (Cont.)



3. A mRNA copy is made from the DNA
template strand by RNA polymerase
4. A mRNA copy is made until it reaches
the termination (stop signal)
sequence
5. The two strands of DNA rejoin.
Template vs. Non Template
Strand
Transcription animations


http://wwwclass.unl.edu/biochem/gp2/m_biology/a
nimation/gene/gene_a2.html
http://www.fed.cuhk.edu.hk/~johnson/t
eaching/genetics/animations/transcripti
on.htm
Transcribe this DNA to mRNA
Think- Pair- Share






1. Where in the cell does transcription occur?
2. What nucleic acids are involved in the process of
transcription?
3. What is the importance of transcription?
4. In transcription, how come the whole DNA molecule
is not copied into mRNA?
5. How does one gene differ structurally from
another?
6. Because one gene differs from another, what
molecules in the cell will also be different?
mRNA Processing


Pre-mRNA – the original sequence of
RNA created during transcription
mRNA reaches the ribosomes
RNA Processing
What is RNA Processing?

After transcription the pre-mRNA molecule
undergoes processing



5’ cap is added
Poly A tail is added to the 3’ end
Introns are removed.
Do Now

Label the Transcription diagram
RNA Processing






In Eukaryotes only
Introns- non-coded sections
Exons- codes for a protein
Before RNA leaves the nucleus, introns are
removed and exons are spliced together
A cap and poly A tail are added to ends of
the sequence
mRNA leaves the nucleus through the nuclear
pores
Why is it necessary to add the poly A tail
and 5’ cap?
Let’s try an activity (11.5)

http://www2.pearsonsuccessnet.com/sn
papp/iText/products/0-13-1150758/index.html
Pg. 339

Pg. 339
Let’s an example…

Original DNA Sequence (DNA):
5’ GTACTACATGCTATGCAT 3’
Translate it (RNA):
3’ CAUGAUGUACGAUACGUA 5’

Add the 5’ cap:




3’ CAUGAUGUACGAUACGUA 5’
cap
Finish the job!

Remove the introns “UGUA” and “AUAC”:
3’ CAUGAUGUACGAUACGUA 5’
3’ CAUGACGGUA 5’
cap
Add a poly A tail onto the 3’ end
Poly A tail
3’ CAUGACGGUA 5’
cap
cap
Get a new partner!




DNA Strand of non-template strand:
5’ ATCGGTAGAGTATTTACAGATA 3’
Remove introns:
CGGUA
UUACAG
Think, Pair, Share





Take a minute think on your own, then pair
with your partner, and share your ideas!
Evolutionary, why do you think there are
introns?
Where did they come from?
Why do we have them?
Remember there is NO wrong answer!
PROTEINS!
Proteins are made up of
amino acids!!!



Proteins are polymers of amino acids
Only 20 different amino acids
BUT there are hundreds of thousands of
different proteins
How can this be?
Let’s compare to it to the
English language
How many letters are in the alphabet?
A,b,c,d,…
26
 How many words are there?
Miss, Ings, is, smart, ..
Almost infinite!
 Each word has a unique structure of letters.


Similar to proteins and amino acids
Proteins- (PCFNa)
-made of 20 different Amino Acids
- Amino Acids bond to form polypeptide
chains
How do amino acids form
these peptide chains?
Peptide Bonds – Link each amino acids
together to form proteins
How many amino acids are in
a dipeptide chain?
How about a tripeptide chain?
How many water molecules are
formed from 2 amino acids?
How many water molecules are
formed from 100 amino acids?
Do Now




Perform transcription on this DNA segment:
GCTTCATACGA
Do RNA processing and remove the introns:
GAA and UGC
How does this mRNA sequence leave the
nucleus?
Where does it go?
Protein
Structure
http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm
Translation


Production of proteins from mRNA
mRNA goes to the ribosomes in the
cytoplasm or the RER and produces
proteins
Steps to Translation


1. mRNA leaves the nucleus and binds to
a ribosome
2. the 5’ end of mRNA binds to ribosome
Ribosome





Two subunits to the ribosome
3 grooves on the ribosome (A, P, E)
A: tRNA binding site
P: polypeptite bonding site
E: exit site
Steps to Translation (Cont.)

3. Ribosome looks for the start Codon
(AUG)

Codon: group of 3 nucleotides on the
messenger RNA that specifies one amino
acid (64 different codons)
Steps to Translation (Cont.)


4. Amino acids attached to a tRNA
molecule and are brought over to the
mRNA.
5. This tRNA has an anticodon that
matches the codon on the mRNA strand
Anticodon:
Group of 3 unpaired
nucleotides on a tRNA
strand. (binds to mRNA
codon)
tRNA
Think-Pair-Share

The mRNA sequence reads the
following codons: What amino acids do
they stand for?




AUG
GGA
GAG
CAA
** What amino acid does the anticodon CGU
stand for?***
Steps to Translation (Cont.)



6. tRNA binds to the mRNA sequence and
adds an amino acid
7. Each amino acid matches up with 1-6
tRNA molecules
8. tRNA leaves and amino acids bond
together through a polypeptide bond
Think – Pair - Share


Find the amino acid sequence for the
following mRNA sequence (translation)
AUGCGACGAAUUUAA
Translation Animations


http://wwwclass.unl.edu/biochem/gp2/m_biology/a
nimation/gene/gene_a3.html
http://www.stolaf.edu/people/giannini/fl
ashanimat/molgenetics/translation.swf
Steps to Translation (Cont.)


9. The mRNA sequence continues until
a stop codon is reached.
10. The amino acids disconnect from
the mRNA sequence and a protein is
formed.
Think-Pair-Share

Get with a partner, one partner transcribes
and the other translates.
Do Now
Do transcription on this DNA sequence:
CGTACGCTCCCTAGACTA

Do Translation- Remember to start the
right place!
Do Now
Do transcription on this DNA sequence:
TTTTATACTGAGGGTTAACTCGT

Do Translation- Remember to start the
right place!
1.
2.
3.
4.
5.
6.
1. Initiation



The two ribosomal subunits come
together with the mRNA and the first
tRNA molecule which attaches to the
start codon (AUG).
This is the only tRNA that will attach to
the P site.
The first amino acid is always
methionine.
2. Codon Recognition

The tRNA anticodon will hydrogen bind
to the mRNA codon in the A site.
3. Bond Formation

The amino acid in the P site will form a
peptide bond with the amino acid in the
A site.
4. Translocation

The tRNA's and the mRNA move down
one site. The empty tRNA is released
from the exit site.
5. Repeat

This process will repeat hundreds of
times.
6. Termination


Translation is terminated with the
stop codon is reached. There are three
different stop codons UGA, UAA, UAG.
The release factor recognizes the stop
codon and releases the polypeptide
strand. All the factors break apart and
are reused.
Do Now



Take the following amino acid sequence, do
reverse transcription and translation (find
RNA and DNA).
Methionine, Arginine, Alanine, Serine,
Tryptophan, Tyrosine, Leucine, Valine,
stop
What do you notice about your DNA
sequences?
Do Now

Template strand of DNA:
5’ TTACGGCTAGGAGTAGCCGAATTCTG 3’

Remove the introns: CUCAUC

Determine protein sequence

Do Now
How do cells know what
protein to make when?

Gene Regulation: ability of an
organism to control which genes are
transcribed.
Controlling Transcription


Transcription factors ensure that a gene
is used at the right time and that
protein are made in the right amounts
The complex structure of eukaryotic
DNA also regulate transcription.
HOX Genes




Everyone develops from a zygote
Zygote undergoes mitosis
Cell differentiation: cells become
specialized
Certain gene sequences determine cell
differentiation
HOX Genes
 Homeobox Genes
(Hox Genes) are
sequences of DNA
 Hox genes are
responsible for the
general body pattern
of most animals.
HOX Genes


Are transcribed at specific
times, and located in specific
places on the genome
Mutations:
Telephone


We are going to play the game
telephone.
Every time a DNA makes a copy
(spreading of a message), mutations
can happen (mistakes in a message)
Mistakes in DNA



Cell make mistakes in replication, and
transcription
Most often these mistakes are fixed
EX.
Mutations


A permanent change that occurs in a
cell’s DNA is called a mutation.
Three types of mutations:



Point mutation
Insertion
Deletion
Point Mutation

Substitution: A change in just one base pair


Missense Mutation: amino acid is change
Nonsense Mutation: amino acid is changed to a
stop codon
Frameshift Mutations



Causes the reading
frame to shift to the
left or the right
Insertion: Addition
of a nucleotide
Deletion: Removal
of a nucleotide
ACGAAATACAGACAT

Decide what type of mutation occurred:

ACGAAATAGAGACAT

ACAAATACAGACAT

ACGAAATACAGGACAT
Causes of Mutations




Mutations can happen spontaneously
Mutagens: Certain chemicals or
radiation that can cause DNA damage
Causes bases to mispair and bond with
the wrong base
High-energy forms of radiation, such as
X rays and gamma rays, are highly
mutagenic.
Sex Cell vs. Somatic Cell
Mutations
 Somatic cell mutations are not passed
on to the next generation.
 Mutations that occur in sex cells are
passed on to the organism’s offspring
and will be present in every cell of the
offspring
Chromosomal Mutations

Piece of chromosome can be broken off,
duplicated, or moved to another
chromosome
Fragile X Syndrome


Repeat of CGG about
30 times
Causes mental and
behavior impairments
Protein Folding and Stability



Substitutions also can lead to
genetic disorders.
Ex. Sickle Cell Anemia (caused
by a substitution mutation)
Can change both the folding
and stability of the protein
Sickle Cell Anemia
Causes of Mutations




Mutations can happen spontaneously
Mutagens: Certain chemicals or
radiation that can cause DNA damage
Causes bases to mispair and bond with
the wrong base
High-energy forms of radiation, such as
X rays and gamma rays, are highly
mutagenic.
Sex Cell vs. Somatic Cell
Mutations
 Somatic cell mutations are not passed
on to the next generation.
 Mutations that occur in sex cells are
passed on to the organism’s offspring
and will be present in every cell of the
offspring