Chapter 17.

download report

Transcript Chapter 17.

Chapter 17.
Mutations
AP Biology
Adapted from: Kim Foglia,
Explore Biology
Universal code
 Code



is redundant
several codons for
each amino acid
“wobble” in the tRNA
“wobble” in the
aminoacyl-tRNA
synthetase enzyme
that loads the tRNA
AP Biology
Mutations

Point mutations
single base change
 base-pair
substitution


silent mutation
 no amino acid change
 redundancy in code

missense
 change amino acid

nonsense
 change to stop codon
When do mutations affect the
next
generation?
AP
Biology
Point mutation leads to Sickle cell anemia
What kind of mutation?
AP Biology
Sickle cell anemia
AP Biology
Mutations

Frameshift

shift in the reading
frame


insertions


changes everything
“downstream”
adding base(s)
deletions

AP Biology
losing base(s)
What’s the
value of
mutations?
AP Biology
Adapted from: Kim Foglia,
Explore Biology
Chapter 17.
RNA
Processing
AP Biology
Adapted from: Kim Foglia,
Explore Biology
Transcription -- another look

The process of transcription includes
many points of control
when to start reading DNA
 where to start reading DNA
 where to stop reading DNA
 editing the mRNA
 protecting mRNA as it travels through
cell

AP Biology
Primary transcript

Processing mRNA


protecting RNA from RNase in cytoplasm
 add 5’ cap
 add polyA tail
remove introns
AUG
AP Biology
UGA
Protecting RNA

5’ cap added


G trinucleoside (G-P-P-P)
protects mRNA


from RNase (hydrolytic enzymes)
3’ poly-A tail added


50-250 A’s
protects mRNA


from RNase (hydrolytic enzymes)
helps export of RNA from nucleus
UTR
AP Biology
UTR
Dicing & splicing mRNA

Pre-mRNA  mRNA

edit out introns


splice together exons


expressed sequences
In higher eukaryotes


AP Biology
intervening sequences
“AVERAGE”…
“gene” = 8000b
pre-mRNA = 8000b
mature mRNA = 1200b
protein = 400aa
lotsa “JUNK”!
90% or more of gene can be intron
no one knows why…yet
 there’s a Nobel prize waiting…
Discovery of Split genes
Richard Roberts
NE BioLabs
AP Biology
Philip Sharp
MIT
1977 | 1993
adenovirus
common cold
Splicing enzymes

snRNPs



small nuclear RNA
RNA + proteins
Spliceosome


several snRNPs
recognize splice site
sequence


cut & paste
RNA as ribozyme


AP Biology
some mRNA can
splice itself
RNA as enzyme
Ribozyme

RNA as enzyme
Sidney Altman
Yale
AP Biology
Thomas Cech
U of Colorado
1982 | 1989
Splicing details

No room for mistakes!
editing & splicing must be exactly accurate
 a single base added or lost throws off the
reading frame
AUGCGGCTATGGGUCCGAUAAGGGCCAU
AUGCGGUCCGAUAAGGGCCAU
AUG|CGG|UCC|GAU|AAG|GGC|CAU
Met|Arg|Ser|Asp|Lys|Gly|His

AP Biology
AUGCGGCTATGGGUCCGAUAAGGGCCAU
AUGCGGGUCCGAUAAGGGCCAU
AUG|CGG|GUC|CGA|UAA|GGG|CCA|U
Met|Arg|Val|Arg|STOP|
Alternative splicing

Alternative mRNAs produced from same gene


when is an intron not an intron…
different segments treated as exons
Hard
to define
a gene!
AP Biology
Domains

Modular architecture
of many proteins


AP Biology
separate
functional &
structural regions
coded by
different exons
in same “gene”
The Transcriptional unit (gene?)
enhancer
1000+b
20-30b
3'
RNA
TATA
polymerase
translation
start
TAC
translation
stop
exons
transcriptional unit
5'
DNA
ACT
DNA
UTR
promoter
UTR
introns
transcription
start
transcription
stop
5'
pre-mRNA
AP Biology
5'
GTP mature mRNA
3'
3'
AAAAAAAA
Any Questions??
AP Biology
Adapted from: Kim Foglia,
Explore Biology
The Transcriptional unit
enhancer
exons
1000+b
20-30b
3'
RNA
TATA
polymerase
TAC
transcriptional unit
5'
DNA
ACT
introns
5'
3'
5'
AP Biology
3'