Transcript 投影片 1
What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale Microarray Replication Transcription DNA Translation RNA Protein Reverse transcription DNA mRNA cDNA ATATCGGCATCAGTCGATCGATCATCGATCGAT UAUAGCCGUAGUCAGCUAGCUAGUAGCUAGCUA ATATCGGCATCAGTCGATCGATCATCGATCGAT What Is Microarray Different Approaches How DNA sequences are laid down Length of DNA sequences Stanford/ Synteni Spotting Affymetrix Photolithography cDNA(Complete Oligonucleotides sequences) Affymetrix Probe Array (Photolithography) Synthesis of probe Hybridization Stanford Approach Use robot to spot glass slides Able to measure qualitatively relative expression levels of genes Differential expression by use of simultaneous, two-color fluorescence hybridisation Cheaper with DIY ($60,000) Also called home-made system Life Cycle(cont.) Cy3 (green) Cy5 (red) Procedures Preparation Reaction(Droplet or Pin Spotting) Target DNA (reference and test samples) Slides Hybridization Scanning Analysis Image processing Data mining Modeling Arrayer Scanner Hardware Software Instruments Arrayer Scanner Laser Confocal Microscope Arrayer Scanner GenPix 4000 Problems – by direct view Anti-probe Precipitate Locally high background Locally low signal Spot overlap Comet-tails (donut hole) Problems –related wit IP Local problems Spot position variation Spot shape and size irregularity Spot Overlapping Global problems High background Low signal White-noise/Speckle effect (Contamination) Array Alignment Good Alignment Bad Alignment Spot Finding Grid System Determination Manual Semiautomatic Automatic Spot Segmentation Space-based Intensity-based Frequency-based Hybrid approach Grid System Determination Spot Segmentation Spot Segmentation(cont.) Applications Gene expression studies Gene function for cell state change in various conditions Disease Diagnosis Pathogen Analysis Applications(Cont.) Drug Discovery identify appropriate molecular targets for therapeutic intervention monitor changes in gene expression in response to drug treatments Trageted Drug Treatment Example Images – E. Coli Example Images – C. Elegan Gene index 1.75 Log(R/G) ….. ….. Log(R/G Log(R/G ….. ….. ….. ….. ….. ….. ) Log(R/G … ) ) M experiments N gene …..